• Ogłoszenia

    • rafcio

      Nowa Wersja Forum   28.07.2016

      Widzisz problemy skontaktuj się z Nami: redakcja@biomist.pl

CPU68C

Użytkownicy
  • Zawartość

    2
  • Rejestracja

  • Ostatnia wizyta

Reputacja

0 Licznik lajków.

O CPU68C

  • Urodziny

Informacje profilowe

  • Płeć
    Mężczyzna
  1. Wizualizacja sekwencji DNA wynaleziona w 2015 przez polskiego uczonego Grzegorza Podgórniaka, powyżej ta sekwencja - GCGGCTTCCTACCTTTAGCTCCGAGTATAGTGAGGCCTAGATATGCGCGGGCAGGTAGCTACAGTGTATACATGCTCGTTCTGCGGCATGCGGATATAAATTAAGGATAATACTCAAGTGTTCCAGGGGAGCAGTCATAAAGCACAACTTCATTATCCCTAAGCTCAGTTAATCTAAGCATGTTTAGCGCTAAGTCTCGTCTACGCGGCAAATACTTTGTAAGCGTTTCTTTAACTTGCCGCTCTCAGAAGGGGCACGGCCGTCATTATGTAACAAGAACGAGTCTCTTACTGGTTGTGCGAGTGGAATGGAGCAACGATGTACGTGTACCGGAAATTTCTAAGGTTTCCCGGCGTATCGATCAAGTCCAGGTTACCGCCTCCCGACAAGGGTATGCTCAACATCCACTGCTGCTGTCCTACGCTCCCTTGGAGACCAATCCTGCGTCATTCAAACTTCGAACATGCGCCGGCATTGTATGTTCATGCCGATAGTGGGTTCATGTTGTGTTATTTACATTCACTGAGTGGCTTCTGCATGTTTCTGGCTCGCCCGAGACTGATCACGCAAAAAATCTCAGAGATGAACTCAA CTGTACCCGTATAATTGGACCAAAGCTGTCGCGCAGCCGTTACGTGCGTATAGTAAATCCAATTTGCTGCAAATTCAACAAAAAAGACAGGCTCACGATGCGACGATATTTTGATAATTTTCTAGCGGGCTCGGCCAGCGTACAGTGAGAGTTTACTGGTGGCGGCGCTGCTAACACGAGTT opis koncepcji i aplikacja są dostępne tutaj: http://studia.scienceontheweb.net/visualization.php