• 0
CPU68C

sekwencje, sekwencja DNA, nukleotydów, genotyp, genom, informacja genetyczna - V

Question

Sekwencja_DNA.gif?uselang=pl

 

Wizualizacja sekwencji DNA wynaleziona w 2015 przez polskiego uczonego Grzegorza Podgórniaka, powyżej ta sekwencja -

 

GCGGCTTCCTACCTTTAGCTCCGAGTATAGTGAGGCCTAGATATGCGCGGGCAGGTAGCTACAGTGTATACATGCTCGTTCTGCGGCATGCGGATATAAATTAAGGATAATACTCAAGTGTTCCAGGGGAGCAGTCATAAAGCACAACTTCATTATCCCTAAGCTCAGTTAATCTAAGCATGTTTAGCGCTAAGTCTCGTCTACGCGGCAAATACTTTGTAAGCGTTTCTTTAACTTGCCGCTCTCAGAAGGGGCACGGCCGTCATTATGTAACAAGAACGAGTCTCTTACTGGTTGTGCGAGTGGAATGGAGCAACGATGTACGTGTACCGGAAATTTCTAAGGTTTCCCGGCGTATCGATCAAGTCCAGGTTACCGCCTCCCGACAAGGGTATGCTCAACATCCACTGCTGCTGTCCTACGCTCCCTTGGAGACCAATCCTGCGTCATTCAAACTTCGAACATGCGCCGGCATTGTATGTTCATGCCGATAGTGGGTTCATGTTGTGTTATTTACATTCACTGAGTGGCTTCTGCATGTTTCTGGCTCGCCCGAGACTGATCACGCAAAAAATCTCAGAGATGAACTCAA CTGTACCCGTATAATTGGACCAAAGCTGTCGCGCAGCCGTTACGTGCGTATAGTAAATCCAATTTGCTGCAAATTCAACAAAAAAGACAGGCTCACGATGCGACGATATTTTGATAATTTTCTAGCGGGCTCGGCCAGCGTACAGTGAGAGTTTACTGGTGGCGGCGCTGCTAACACGAGTT

 

opis koncepcji i aplikacja są dostępne tutaj:

http://studia.scienceontheweb.net/visualization.php

0

Share this post


Link to post

1 answer to this question

Żeby dodać komentarz, musisz założyć konto lub zalogować się

Tylko zarejestrowani użytkownicy mogą dodawać komentarze

Dodaj konto

Załóż nowe konto. To bardzo proste!


Zarejestruj nowe konto

Zaloguj się

Posiadasz już konto? Zaloguj się tutaj.


Zaloguj się teraz